Background: Transposon‐mediated transgenesis is an excellent method for creating stable transgenic lines and insertional mutants. In the chordate Ciona intestinalis, Minos is the only transposon that has been used as the tool for germline transformation. Adding another transposon system in this organism enables us to conduct genetic techniques which can only be realized with the use of two transposons. Results: In the present study, we found that another Tc1/mariner superfamily transposon, sleeping beauty (SB), retains sufficient activity for germline transformation of C. intestinalis. SB shows efficiencies of germline transformation, insertion into gene coding regions, and enhancer detection comparable to those of Minos. We have developed a system for the remobilization of SB copies in the C. intestinalis genome by using transgenic lines expressing SB transposase in the germ cells. With this system, we examined the manner of SB mobilization in the C. intestinalis genome. SB shows intrachromosomal transposition more frequently than Minos. Conclusions: SB‐based germline transformation and the establishment of a new method that uses its frequent intrachromosomal transposition will result in breakthroughs in genetic approaches that use C. intestinalis together with Minos. Developmental Dynamics 242:30–43, 2013. © 2012 Wiley Periodicals, Inc.

INTRODUCTION

The ascidian Ciona intestinalis is an excellent organism for studying genetic functions in the chordate body plan (Satoh, 2003). C. intestinalis shares the basic body plan with vertebrates; namely the dorsally located neural tube, notochord, gill in the pharynx, and endostyle/thyroid gland. The body of C. intestinalis is extraordinarily simple. Its tadpole larva consists of only ∼2,600 cells with 40 notochord, 36 muscle and ∼300 neural cells (Di Gregorio and Levine, 2002). The genome of C. intestinalis is also much simpler than those of vertebrates (Dehal et al., 2002). The genome size of C. intestinalis is estimated to be about 160 mega base pairs (Mbp) per haploid, which contains 15,852 protein‐coding genes. The genome size and gene number are comparable to those of Drosophila melanogaster.

The simple genome of C. intestinalis is advantageous for genetic approaches because (a) the number of genes to be analyzed is small and (b) functional redundancy of the closely related genes, which usually causes complicated results of the phenotypes, is not usually observed (e.g., Sasakura et al., 2003a, b). The generation time of C. intestinalis is about 2 to 3 months, and they can be cultivated in inland culture systems (Joly et al., 2007); such systems which are essential for conducting genetic approaches. With these advantages, C. intestinalis is a splendid model marine invertebrate for conducting analyses of gene functions by molecular and genetic approaches.

Germline transformation is a useful genetic technique for creating transgenic lines that stably maintain transgenes in their genomes. These transgenic lines are invaluable resources as markers for labeling the organs, tissues, cells, or even subcellular components of live organisms with fluorescence of reporter proteins. Germline transformation can also be applied to enhancer detection, a method for determining the local effect(s) of reporter gene expression caused by the surrounding genomic contexts. In enhancer detected animals, the expression of reporter genes is under the influence of enhancer elements of the genomes, suggesting the presence of the enhancers near the insertion sites (O'Kane and Gehring, 1987). Germline transformation is also applied to mutagenesis. Insertions of transgenes in the genomic regions encoding genes destroy gene functions to create mutant alleles. With these applications, transgenic technologies are essential for analyzing genetic functions.

Several methods have been established to create transgenic lines. Among them, transgenesis with DNA transposons is very useful (Ivics and Izsvak, 2010). A major advantage of this method is that the insertion sites of the transposon copies can be identified by simple polymerase chain reaction (PCR) analysis. In C. intestinalis, germline transformation has been reported with a Tc1/mariner superfamily transposon, Minos (Franz and Savakis, 1991; Sasakura et al., 2003c, d). Minos vectors with transposase mRNA are introduced into C. intestinalis embryos by means of microinjection or electroporation, and then transposon copies are inserted into genomes of the germ cells and the insertions are transmitted to the subsequent generations. Usually 30% of Minos‐introduced animals become founders (Sasakura, 2007). Minos‐based transgenesis has been applied to enhancer detection (Awazu et al., 2004) and mutagenesis (Sasakura et al., 2005, 2012). Transgenic lines expressing Minos transposase in the germ cells have also been created (Sasakura et al., 2008; Hozumi et al., 2010), which are used to remobilize Minos copies in the C. intestinalis genome. To date, Minos is the only transposon which has been applied to germline transformation in C. intestinalis.

Although the Minos‐based transformation of C. intestinalis is a reliable method, other methods of germline transformation are better for further applications of transgenic technologies (Huet et al., 2002; Simmons et al., 2002; Liang et al., 2009). For example, the creation of transgenic lines expressing Minos transposase requires another transformation system because Minos insertions can be remobilized by Minos transposase (Simmons et al., 2002; Sasakura et al., 2008). Likewise, genetic modifications of Minos‐based transgenic lines require another transformation system. Transposons usually have their own bias of insertion sites, and using two or more transposons facilitates saturated mutagenesis (Thibault et al., 2004; Liang et al., 2009). Furthermore, transposons which have different characteristics from Minos will bring us another transgenic technology based on these characteristics, which could not be accomplished with Minos (Huet et al., 2002; Kokubu et al., 2009). There are two reported methods of germline transgenesis of C. intestinalis that do not use transposons: the introduction of a plasmid vector by electroporation into one‐cell embryos can generate stable transgenic lines (Matsuoka et al., 2005). The other method uses I‐SceI endonuclease (Deschet et al., 2003; Awazu et al., 2007).

Although these two methods are useful, they have a disadvantage in that the identification of the insertion sites is difficult compared with transposon‐based insertions. This difficulty is based on the fact that electroporation‐mediated and I‐SceI‐mediated methods usually introduce transgenes in a tandem‐arrayed manner (Sasakura, 2007). The tandem array strongly restricts the amplification of the junction sequences between transgenes and the genome through PCR analyses. It has been reported that Minos‐based transgenesis sometimes introduces transgenes as tandem arrays in C. intestinalis (Sasakura, 2007); however, the copy numbers of transgenes in the arrays are limited, and the insertion sites can be characterized in most cases (e.g., Yoshida and Sasakura, 2012). Transposon‐based transformation has another advantage compared with the other methods, in that transposon copies can be remobilized by inducing the expression of transposases in the germ cells. With such a remobilization, we can create novel transgenic lines by simply crossing the transposon donor lines and transposase‐expressing lines (Sasakura et al., 2008; Hozumi et al., 2010).

For these reasons, the use of another transposon in C. intestinalis is necessary to improve the transgenic technologies of this organism. We have searched for transposons active in C. intestinalis. Among the various transposon vectors, we were drawn to Tc1/mariner superfamily transposons in light of their low host specificity (Lampe et al., 1996; Vos et al., 1996). Sleeping beauty (SB), a Tc1/mariner transposon reconstructed from fish genomes (Ivics et al., 1997), is known as a reliable transformation vector in vertebrates (Luo et al., 1998; Fischer et al., 2001; Horie et al., 2001; Davidson et al., 2003; Grabher et al., 2003; Sinzelle et al., 2006).

We found that SB has excision activity in C. intestinalis embryos (Sasakura et al., 2007). However, its excision activity was low and we were not able to detect its transposition activity, suggesting that some improvements are necessary before using SB as a tool for germline transformation in C. intestinalis. In a previous study, we used SB10, a variant of SB transposase and a pT version of SB transposon vector (Ivics et al., 1997). Their mutated forms, namely SB11 (Geurts et al., 2003), SB100X (Mates et al., 2009), and pT2 (Zayed et al., 2003) have been reported. These mutated forms improved the frequency of transposition in vertebrates (Newman and Lardelli, 2010). In the present study, we examined the activity of these variants in C. intestinalis. We found that the combination of SB100X and pT2 have high enough activity for the germline transformation of C. intestinalis, with efficiency comparable to that of Minos.

RESULTS

Excision Activity of Sleeping Beauty With its Transposase Variants in C. intestinalis

Tc1/mariner transposons are mobilized by the cut‐and‐paste manner (van Luenen et al., 1994). Therefore, their excision from vector DNAs is an essential step for their transformation. To test whether and how effectively SB can be excised from the backbone vector in C. intestinalis embryos, we performed an excision assay (Fig. 1A; Klinakis et al., 2000a; Sasakura et al., 2003a). A plasmid vector which contains an SB transposon was introduced into one‐cell embryos with transposase mRNA. After these embryos reached the late tail bud stage, the DNA was recovered from the embryos, and the presence of excision events was examined by PCR.

**Figure 1**
Open in figure viewer PowerPoint

Excision activity of *sleeping beauty* (SB). A: The scheme of the excision assay. B: An example of the results of the excision assay. The arrow suggests the size of the excised band. M, size marker. The right‐hand numbers indicate the size of the markers in base pairs. Some DNAs were subjected to rearrangement in *C. intestinalis* embryos, and polymerase chain reaction bands derived from such rearrangement were amplified in the lanes for w/o transposase samples. C: Footprints sequences of SB observed in the *C. intestinalis* embryos. Dotted lines represent vector backbones. The “pT2SVneo original” represents the terminal nucleotides of the inverted repeats of pT2. Typical, typical footprint sequences of SB; atypical, atypical footprint sequences. TPson, transposon; TPase, transposase; ORF, open reading frame.

In this PCR analysis, plasmids are amplified with primers flanking the transposon insertion. If excision occurs, the amplicon becomes shorter and the PCR detects the bands corresponding to the excision event. We examined a pT2‐based vector, pT2SV40neo (Mates et al., 2009) and SB11 or SB100X transposase variants. When pT2SV40neo and SB11 mRNA were microinjected into the embryos, 31% of the injected embryos (n = 16) exhibited the PCR bands suggesting the excision of transposon (Fig. 1B). When SB100X was used, the frequency of embryos showing excision was increased to 93% (n = 16; Fig. 1B). When the PCR bands suggesting the excision of SB were sequenced, some of the bands had the typical footprint sequences specific to the excision events mediated by SB transposase (Fig. 1C, typical; Horie et al., 2001). In addition to the typical footprint sequences, some excised bands had incomplete footprint sequences (Fig. 1C, atypical). These atypical footprint patterns were probably generated by the repair system of the C. intestinalis DNA double‐strand break following the excision events by SB transposase (Plasterk and van Luenen, 1997).

Next, we performed quantitative analyses of the excision activity of pT2/SB100X. For this purpose, we used the method reported by Miskey et al. (2007). With this method (Fig. 2A), a pAmp‐based vector is created in which a transposon is inserted into the ampicillin‐resistant gene. The ampicillin‐resistant gene is inactive due to the transposon insertion. We introduced this vector into C. intestinalis embryos with transposase mRNA. After the embryos reached the late tail bud stage, we recovered plasmid DNAs from the embryos and used them to transform E. coli. If excision occurs in embryos, the removal of the transposon insertion from the ampicillin‐resistant gene reconstructed the open reading frame of the gene to restore its activity, and the E. coli with the vector will grow in broth containing ampicillin. The efficiency of the excision was estimated by counting the number of ampicillin‐resistant E. coli colonies. The total number of pAmp vectors recovered from the embryos was estimated by counting zeocin‐resistant E. coli colonies.

**Figure 2**
Open in figure viewer PowerPoint

Excision efficiency of *sleeping beauty* (SB) variants. A: The scheme of the excision assay. B: Frequency of excision of SB and *Minos*. In this experiment, SB100X transposase was supplied as mRNA. C: Comparison of excision frequency among SB transposase variants and *Minos*. In this experiment, transposases were supplied from the expression vectors. TPson, transposon; TPase, transposase; ORF, open reading frame; Ter, transcription termination sequence; Zeo, zeocin‐resistant gene; Amp, ampicillin‐resistant gene.

As shown in Figure 2B, the score of the excision of pAmpT2neo and SB100X mRNA was on average 0.68% of the total pAmpT2neo vector when 20 μg of SB100X mRNA was introduced, and the score was increased to 1.41% when the amount of SB100X mRNA was increased to 80 μg. The highest amount of mRNA (80 μg) in this and following assays was chosen according to the transgenesis of C. intestinalis by electroporation as established in the Minos system (Matsuoka et al., 2005). Minos showed about one‐third lower frequency of excision compared with SB (Fig. 2B).

We conducted a similar comparison of the excision activity among SB transposase variants and Minos by using expression vectors of transposases (Fig. 2A). Expression vectors of transposases were created with a cis element of Ci‐Nut, which drives genes in the neural tissues during embryonic stages (Kitaura et al., 2007). The expression vectors were introduced into C. intestinalis embryos with ampicillin vectors as shown in Figure 2A, and the efficiency of excision was calculated. SB100X showed the highest efficiency of excision compared with SB10 (39‐fold on average) and SB11 (eight‐fold avg.) (Fig. 2C). In this experiment, Minos showed approximately 20‐fold lower excision frequency compared with SB100X. We concluded that SB100X has the highest excision activity among the three variants of SB transposases in C. intestinalis, and its excision efficiency is higher than that of Minos.

SB100X Can Transpose T2 Vector in C. intestinalis

Excised transposon copies must be integrated again into DNA molecules to complete their remobilization. To test whether SB transposon and SB100X have transposition activity in C. intestinalis and to estimate their frequency, we performed a plasmid‐based transposition assay (Fig. 3A; Klinakis et al., 2000a; Sasakura et al., 2003a). Two vectors, one the transposon donor vector and the other the recipient vector, were introduced into C. intestinalis embryos together with 0–80 μg of SB transposase mRNA. In this experiment, if SB has remobilizing activity in this organism, some of the transposon copies will be inserted into the recipient vectors. After the embryos reached the late tail bud stage, plasmid DNAs were recovered to transform E. coli. The E. coli colonies were selected using antibiotics to isolate recipient vectors with transposon insertions. As a result, we detected transposition of SB when SB100X mRNA was electroporated with the donor and recipient vectors, and the frequency of transposition increased according to the amount of transposase mRNA (Fig. 3B). The frequency of SB transposition was approximately six‐fold lower than Minos (Fig. 3B). As mentioned above, the excision frequency of SB is higher than that of Minos, suggesting that the frequency of excision and transposition is not always proportional.

**Figure 3**
Open in figure viewer PowerPoint

Transposition activity of *sleeping beauty* (SB). A: The scheme of the transposition assay. B: Frequency of transposition of SB and *Minos*. tet, tetracyclin‐resistant gene; Kn, kanamycin‐resistant gene; Cam, chloramphenicol‐resistant gene; TPase, transposase; ORF, open reading frame.

Germline Transformation of C. intestinalis With SB

The above results suggested that SB transposon and SB100X have both excision and transposition activity in C. intestinalis. This means that SB100X has the potential to insert SB transposon copies into the C. intestinalis genome. If this event occurs in the germ cells, transgenic lines can be established. We used the following experiments to determine whether SB can transform C. intestinalis. First, we created an SB vector, pT2dTPOG, which contains the promoter of C. intestinalis thyroid peroxidase (Ci‐TPO) gene (Ogasawara et al., 1999; Sasakura et al., 2003b) and the reporter gene encoding green fluorescent protein (GFP). The Ci‐TPO promoter drives GFP at the anterior and posterior ends of the endostyle (Sasakura et al., 2003d). We introduced pT2dTPOG and SB100X mRNA into C. intestinalis embryos by electroporation, cultured the embryos until the reproductive stage, and crossed them with wild‐type animals to obtain progeny. The progeny families were screened first by GFP fluorescence.

As a result, three of nine families included GFP‐positive progeny (Fig. 4A), suggesting that 33% of animals into which pT2dTPOG and SB100X mRNA were introduced became founders to transmit GFP gene to their progeny. This frequency of germline transformation is comparable to the score of Minos with a similar vector design (Sasakura et al., 2003d). When the electroporated animals that exhibited strong GFP fluorescence (indicating that they contained more transgenes than animals showing faint or no GFP fluorescence) were selected before culturing, the transformation frequency was increased to 57% (n = 7).

**Figure 4**
Open in figure viewer PowerPoint

*Sleeping beauty* (SB) causes germline transformation of *C. intestinalis*. A: A green fluorescent protein (GFP) transgenic line generated with pT2dTPOG vector, juvenile stage. This is a merged image of fluorescent and differential image contrast (DIC) images. GFP fluorescence is pseudocolored. GFP fluorescence was observed at the posterior end of the endostyle (arrowhead). B: Genomic Southern blotting analysis of GFP transgenic lines generated with pT2dTPOG vector. The numbers at the left side indicate the size markers in base pairs. The numbers at the top indicate the line ID numbers. The difference in the band size reflects the different insertion sites among transgenic lines.

The insertion of the SB vector in the C. intestinalis genome was shown by a genomic Southern blot analysis using GFP gene as the probe (Fig. 4B). We then characterized the insertion sites of SB and found that SB vector was inserted into the C. intestinalis genome by SB100X (Table 1). We identified 10 insertion sites from six transgenic lines, suggesting that a founder can transmit several insertions to its progeny. SB copies were jointed with the TA dinucleotides of C. intestinalis genome at their inverted repeats. This insertion manner is in accord with that of Tc1/mariner transposons, as previously reported (van Luenen et al., 1994; Ivics et al., 1997), suggesting that SB was inserted into the C. intestinalis genome by SB100X transposase, and not by other mechanisms such as plasmid insertion. Based on the results of these experiments, we concluded that SB and SB100X can transform C. intestinalis to create its transgenic lines.

Table 1. SB insertion sites

Line name	Sequence of insertion sites** The targeted TA dinucleotides are in bold.	Scaffold number in the JGI version 1 genome browser	Nearest gene model**** Gene models in the GHOST database (http://hoya.zool.kyoto‐u.ac.jp/blast_kh.html).	Position in the gene	Chromosome
Line 1	taTATCAAACCATTCATGCTTTTGGTTCCACAAACAACTT	2	KH.C3.360	Intron	3
	taTGTTATAGCTCGACAGTAAGCATGAGGTGTATAAATAC	8	KH.C6.141	Intron	6
	taGGTATATATGTGCCGCGCATATTTAATGACTTTTATGA	39	No gene model	‐	10
Line 3	taTACACATATATTTCGTCTTTTTAATGTAAAAGAATCTG	181	KH.C2.827	37 bp downstream	2
Line 4	taCATTGCAGTAGTAAATATGTGCTGGGAAATTGATGCAT	551	No gene model	‐	10
Line 5	taTATAGTGATAAAGCGGGTTCACCTTATAGTAAATCAGA	115	No gene model	‐	‐
Line 6	taACTCAACACATGGTATTATTGAAACAGACAGTTAACAG	446	No gene model	‐	5
Line 6	taTATTTTGTTTGGTTTTGGTGCCATGAAAACGTAACAGA	242	KH.C7.151	Intron	7
Line 7	taTATATATGCCCAACGTGTCAGCATTTTTCGCTTTTTAT	59	KH.C1.666	Intron	1
	taTGTATTGTGCGTGTGAGTTTCTGGCTCGGTCTACCGGC	39	KH.C10.330	Intron	10

* The targeted TA dinucleotides are in bold.
** Gene models in the GHOST database (http://hoya.zool.kyoto‐u.ac.jp/blast_kh.html).

Remobilization of SB in the C. intestinalis Genome

One of the advantages of transposon‐based transformation is that transposon copies can be remobilized in the genome by expressing transposase in the germ cells to create new insertions. We examined whether this experimental system can be established for SB in C. intestinalis. First, we needed to create transgenic lines expressing SB100X in the germ cells. Two expression vectors were created that drive SB100X in the germ cells. One vector uses a cis element of the gene encoding protamine (Ci‐prm), which drives gene expression in sperm (Sasakura et al., 2008). The other vector, for oocytes/eggs, uses a cis element of Ci‐Nut (Fig. 5A; Hozumi et al., 2010), which exhibits expression in both neural tissues and oocytes. Both of the cis elements have been used for establishing the transposase lines of Minos (Sasakura et al., 2008; Hozumi et al., 2010). A CFP marker cassette was inserted next to the transposase cassettes for visual markers of transgenic lines of these vectors (Fig. 5A). These expression cassettes were inserted between Minos inverted repeats, and transgenic lines were created with Minos‐based transgenesis. Two lines and one line were used for the Ci‐prm‐based and Ci‐Nut‐based transposase lines, respectively (Fig. 5B). Hereafter we refer to the Ci‐prm‐based transposase lines as “the male transposase lines,” and the Ci‐Nut‐based transposase line as “the female transposase line.” The expression of SB100X in the testes of the male transposase lines and in the unfertilized eggs of the female transposase line was shown by reverse transcription (RT) ‐PCR of these tissues/cells (Fig. 5C,D). Progeny derived from SB100X‐expressing sperm and eggs showed normal morphology, suggesting that the expression of SB100X in these cells does not cause an opposing defect for development (Fig. 5B). Two SB transgenic lines (Tg[T2dTPOG]1 and Tg[T2dTPOG]3) described in the previous section were used as transposon donor lines. For simplicity, they are respectively called “transposon donor lines 1 and 2” in the following sections.

**Figure 5**
Open in figure viewer PowerPoint

Remobilization of *sleeping beauty* (SB) in the *C. intestinalis* genome. A: Design of transposase‐expression vectors. Black arrowheads at the termini indicate the inverted repeats of *Minos*. Ter, transcription termination sequence. B: A juvenile of the female transposase expression line Ju[MiFr3dTPOCCiNutSB100X]2. Left, a bright‐field image showing its normal morphology. Right, CFP fluorescent image. Scale bar = 100 μm. C: Expression of SB100X mRNA in the testes of male transposase lines, as revealed by reverse transcriptase‐polymerase chain reaction (RT‐PCR). *EF1a* was used as positive controls of the reverse transcription. M, size maker lane. The right‐hand numbers indicate the size of the markers in base pairs. RT “—” lanes indicate negative controls without reverse transcription. D: Expression of SB100X mRNA in the unfertilized eggs of the female transposase line, as revealed by RT‐PCR. *GAPDH* was used as positive controls of the reverse transcription. M, size marker lane. The left‐hand numbers indicate the size of the markers in base pairs. E: CFP and GFP fluorescence of a double‐transgenic animal between a transposon donor line and transposase line, juvenile stage. The right panel is the merged image of CFP, GFP, and DIC images. **F–H:** GFP fluorescence of enhancer detection lines generated by remobilization of SB, juvenile stage. In F, GFP was expressed in the digestive tube. In G, GFP was expressed in the endostyle. In H, GFP was expressed in the epidermis. I: SB transposon was remobilized from the donor site to create new insertions by expressing SB100X in the germ cells. The position of the band suggesting the presence of the original SB insertion is indicated by an arrowhead. The original bands are negative in lanes 1, 3, 4, 8, 9, and 10, suggesting that these animals had insertions different from the transposon donor site. “GFP” indicates positive controls of the genomic PCR, showing that the examined juveniles have *GFP* insertions. M, size marker lane. The left‐hand numbers indicate the size of the markers in base pairs.

The male transposase lines were crossed with transposon donor lines to create double‐transgenic animals (Fig. 5E). The sperm of the double‐transgenic animals was collected to fertilize eggs of wild types to obtain progeny. The GFP expression of the progeny was observed to see whether some of the progeny showed a GFP expression pattern different from that of the transposon donor. When male transposase line 2 and donor line 2 were used, approximately 1.7% of the progeny showed GFP expression in tissues additional to those of the transposon donor line (Fig. 5F–H; Table 2). The different GFP expression pattern from the donor line was probably caused by the position effect of the transposon insertion sites, such as enhancer detection, suggesting that the transposon insertion sites of the progeny were different from that of the transposon donor.

Table 2. GFP expression patterns of progeny from the double transgenic animals between transposon donor and transposase lines

Line ID	GFP expresstion pattern		GFP negative	CFP expression
Line ID	Donor pattern** The same GFP expression pattern as the transposon donor line, as is shown in Fig. 4A.	Enhancer detection	GFP negative	CFP expression
Tg[T2dTPOG]3 x Ju[MiCiprmSB100X]2	837/1467 (57.1%)	25/1467 (1.7%)	605/1467 (41.2%)	768/1467 (52.4%)
Tg[T2dTPOG]1 x Ju[MiCiprmSB100X]1	443/921 (48.1%)	0/921 (0%)	478/921 (51.9%)	470/921 (51.0%)
Tg[T2dTPOG]1 x Ju[MiCiNutSB100X]2	1274/2345 (54.3%)	12/2345 (0.5%)	1059/2345 (45.2%)	1113/2345 (47.5%)

* The same GFP expression pattern as the transposon donor line, as is shown in Fig. 4A.

We did not find enhancer‐detected progeny derived from double transgenic animals between the male transposase line 1 and donor line 1 (Table 2), suggesting that the frequency of remobilization differs among transgenic lines. A similar experiment was carried out for double‐transgenic lines between the female transposase line and transposon donor line 1. In this case, 0.5% of the progeny derived from the eggs of the double‐transgenic animals exhibited enhancer detection patterns of GFP expression (Table 2), suggesting that remobilization occurs in oocytes as well as spermatocytes. The appearance ratios of the progeny with the enhancer detection pattern were comparable to those obtained with the same system using Minos (1.0–4.2% in the male germ cells and 0–2.6% in the female germ cells; Sasakura et al., 2008; Hozumi et al., 2010).

Even though most progeny derived from the double‐transgenic animals exhibited the same GFP expression pattern as that of the transposon donor lines, there remains a possibility that the population includes animals with different insertion sites from the donor line, because the GFP expression pattern of the transposon donor is caused by the constitutive activity of the cis element of Ci‐TPO. To examine this possibility, we performed genomic analyses of these progeny to amplify the insertion site of the transposon donor line. The progeny from the double‐transgenic animals between the male transposase lines and the transposon donor lines were analyzed. We predicted that if the progeny had the same insertion site from the transposon donor, they would be PCR‐positive; we found that approximately 21%–26% of the progeny were negative in this PCR analysis (Fig. 5I), suggesting that they have insertion sites different from those of the transposon donor.

The above results suggest that SB transposon copies were remobilized in the chromosomes of germ cells. To directly show the evidence of remobilization, we identified the insertion sites of the progeny which were suggested to have insertion sites different from those of the donor. We identified 37 insertion sites which were different from the donor sites (Table 3). Therefore, remobilization of SB transposon in C. intestinalis chromosomes was achieved with the transposase lines.

Table 3. Insertion sites of SB generated by the remobilization of SB transposon

Transposon donor	Enhancer detection	Sequence	Scaffold number in the JGI version 1 genome browser	Nearest gene model	Position in the gene	Chromosome
Line 1		taTATGATAATATACATTTGCATGTTTTTCACTTTTATTT	‐	gw1.01q.1834.1	459 bp upstream	1
	yes	taTGTAGCTTCTTATCATCCATTGACTTGTAGTATTAGGA	187	No gene model	‐	2
		taTAAGTTGCAGCAGTTGGCATGACTACTTATTCAGTCCC	2	KH.C3.360	598 bp upstream	3
		taCATATTTCTCGCAAACACAAAATAAACCGACCCAGTGG	39	KH.C10.59	Intron	10
	yes	taTAAAGGTAGCAAAATGTTGTGAAATTTACCTCACACTT	511	KH.S511.2	Intron	10
		taCATTTATCGTTAATATTGTTTATGGCGTCCCCGTCCTA	39	No gene model	‐	10
	yes	taTGTGCTACGTGATTTAGCAACAGATTGTGACGTGATAA	12	No gene model	‐	11
	yes	taTATATTACACTGTTTTGCCCGACCATGCAATATCCAAC	615	KH.S615.2	Intron	‐
	yes	taTATATCTCCCCCTCCATAATTCAACCTGGATATTATGC	889	KH.L18.44	Exon	‐
Line 2	yes	taTATAGCAGGGTGGCAGAAGTAAAGACACCTTTAGCATA	329	KH.C1.1180	Intron	1
		taCCAATACAGTCTAAGTGCCGGACAAATTGTAACAATCA	5	KH.C2.442	Exon	2
	yes	taCATATTTTAAAATGCATTAAAATGTATTTTTTACATGT	15	KH.C2.771	Intron	2
		taGGTCACCTAACATGCCTCCTGTAGAACCTCTCGCATGA	175	KH.C2.784	Intron	2
		taTATAGTAATGACAAAACTGAATAGAAATGTAAATATTT	175	KH.C2.439	Intron	2
		taGTTGTAATTCAACTTTTAAGTGCGTCATAATCTATTGG	181	KH.C2.1050	Intron	2
		taTATACATTCTATGCTATTTCAAGTAAATTAAAACAAGA	405	KH.L108.38	Intron	2
	yes	taCATGAAGCATGAAACATGTATATTTCACGCGTATCCAC	1952	KH.C2.116	Intron	2
		taTATATTATCTATAGAGTGTTGTTTTTTTTGTTATTGTT	184	KH.C3.919	Intron	3
	yes	taCATGGTGACTCGTAAGCGGGTACTTTTCTATATCAAGT	296	No gene model	‐	3
		taTATGGAATGTTATGTGATGAGAAAAGTGTCGATAGTAT	26	KH.C4.757	Exon	4
		taTATACTTTAAACCAGAAGAACGCTTTACTATATACAGT	144	No gene model	‐	4
		taTATGCAAGTTCTTAACGTGGGTAAGTTTGTTGATTATG	144	gw1.04q.150.1	Intron	4
		taTATGTAGGCCTATCTGTTTTTACTCACGGCGTCTTTTA	42	KH.C5.92	Intron	5
		taTGTTCTCCAGTTCCTTCATCCCTTCATCGTTCGCTGTT	43	KH.C5.369	Exon	5
		taCATGTAAATTTAATATACATTTAACTGTAAAATTAAAA	52	KH.C7.340	Intron	7
	yes	taTCTATCCCACCTGTGGGTTCCTTGTTTGCGCGAGTATT	368	KH.C7.711	Intron	7
	yes	taTATATACAATGCTTTAGTTAAGAGGAAAAGGATAGCAC	237	KH.C9.661	Intron	9
		taTACTAGTTTCACATTTGTCAATCGCATGTCGTTATATT	266	No gene model	‐	9
		taTATATACTTATACAGCTTTTGCCTGTATTTTACATCTT	319	No gene model	‐	9
		taCATGGTAACTCGTAAACTGGCACGAAGTGTATGAAACA	343	KH.C9.519	Intron	9
		taCATAGGAGACATCCTCATAATCGTTGTGGTCGTCACCA	660	KH.C9.454/ KH.C9.167	Exon	9
		taGATATAAGCATATAAATATTATGGTGATTGATTATTAA	785	KH.L151.5	Intron	9
		taTATGGAGTTGAAAACAGACAATTTAAAATAAGTGATTT	9	KH.C10.249	Intron	10
		taCATATGTTTGTCTAAATTATGTGAAGCAGCAGTTATAC	371	KH.C10.424	Intron	10
	yes	taTGTCATAATCTGTTTGAATAAAATAATACGTTAATTTT	124	KH.C12.508	680 bp downstream	12
		taCAATGTTGGGTAATGGGCCAACTCTGGCCTAAATCCCA	623	KH.L108.25	1.8 kbp downstream	‐
		taCTTGCCATGAAACCGTAAGCTACCACGACAATTTACTG	748	KH.L141.37	Exon 16	‐

The Tendency of the SB Insertion Sites in the C. intestinalis Genome

In the above experiments, we characterized a total of 47 insertion sites of SB. The insertion sites are listed in Tables 1 and 3. We analyzed these SB insertion sites to observe any tendencies in the C. intestinalis genome, and we found that SB copies were clearly inserted into the TA‐rich sequences (Table 4). In addition, 64% of the insertion sites occurred at two or more tandem repeats of the TA dinucleotides. Because the C. intestinalis genome has been estimated to contain approximately 65% T and A nucleotides (Dehal et al., 2002), the probability of the appearance of another TA dinucleotide adjacent to the TA sites targeted by SB should be approximately 21%, a value that is lower than the value observed in the present analysis. This suggests that SB is preferably inserted in the tandem repeats of TA in C. intestinalis.

Table 4. SB are preferably inserted into tandem TA repeats

Genome sequence around the targeted TA dinucleotides** The targeted TA dinucleotides are in bold.	The number of TA repeats**** The numbers include the TA dinucleotides targeted by SB.
AACACATAtaTATCAAAC	3
AAGACACCtaTGTTATAG	1
AAAAGACAtaGGTATATA	1
ATGGAATAtaTACACATA	3
CTTCTATAtaCATTGCAG	3
CGCACAAGtaTATAGTGA	3
ATGCTATAtaACTCAACA	3
TTGTAATGtaTATTTTGT	2
TCATAAGCtaTATATATG	4
TACCTACCtaTGTATTGT	1
AGATCAATtaTATGATAA	2
AGCCCAGGtaTGTAGCTT	1
ACGGTATAtaTAAGTTGC	4
ACGCTACAtaCATATTTC	1
CATCCCTAtaTAAAGGTA	3
GGTATACCtaCATTTATC	1
TAACGACAtaTGTGCTAC	1
CACACACAtaTATATTAC	3
ATGCCACCtaTATATCTC	3
CACATATGtaTATAGCAG	3
CACAAATGtaCCAATACA	1
ATAACATAtaCATATTTT	2
TGAAAACCtaGGTCACCT	1
TATACATCtaTATAGTAA	3
TGGGTACGtaGTTGTAAT	1
GCTAGATAtaTATACATT	4
TTAAATAAtaCATGAAGC	1
AGTGTATGtaTATATTAT	3
AAGCTACAtaCATGGTGA	1
TGGTGGTAtaTATGGAAT	3
GTACATATtaTATACTTT	3
GAATTACCtaTATGCAAG	2
GATACGTGtaTATGTAGG	2
GGTCTATAtaTGTTCTCC	3
TTTTTATAtaCATGTAAA	3
ATATAAGAtaTCTATCCC	1
CCAGTATCtaTATATACA	4
AGAACATAtaTACTAGTT	3
AATATAGTtaTATATACT	4
AAGCTACAtaCATGGTAA	1
TTGGCTTAtaCATAGGAG	2
ATTAATTCtaGATATAAG	1
TTTATACTtaTATGGAGT	2
TTCATATAtaCATATGTT	3
GCCATATGtaTGTCATAA	1
TGTCCATAtaCAATGTTG	2
TGGCAACAtaCTTGCCAT	1

* The targeted TA dinucleotides are in bold.
** The numbers include the TA dinucleotides targeted by SB.

Next, we analyzed the tendency of the insertion sites of SB relative to genes in the genome (Tables 1, 3). Approximately 66% of the insertion sites are located inside of genes, and 8.5% are within 1 kb upstream or downstream from the gene coding region. Therefore, SB showed a higher probability to be inserted inside or near the genomic region encoding genes compared with intergenic regions. This higher probability for hitting genes may be due to the compact genome of C. intestinalis (Dehal et al., 2002) rather than the nature of SB. Among the insertions inside gene coding regions, 19.4% were found to be in exons, and the remaining 80.6% were in introns. The score for hitting exons is slightly higher than that of Minos (∼18%; Hozumi et al., 2010).

One outstanding character of the SB transposon is the high frequency of intrachromosomal transposition (Fischer et al., 2001). In contrast, Minos shows interchromosomal transposition more frequently than intrachromosomal transposition in the C. intestinalis genome (Hozumi et al., 2010). To examine the tendency of SB remobilization in the C. intestinalis genome, we mapped the insertion sites of SB generated by the remobilization experiments onto chromosomes (Fig. 6). When the transposon was supplied by donor line 2, 26 of the 28 characterized insertion sites could be mapped onto chromosomes, and 27% of them were present in the same chromosome as the donor site (Fig. 6A).

**Figure 6**
Open in figure viewer PowerPoint

Tendency of remobilization of *sleeping beauty* (SB) in the *C. intestinalis* chromosomes. A: Results of transposon donor line 2, which has an SB insertion in chromosome 2. *C. intestinalis* chromosomes are represented by bars (Shoguchi et al., 2008). The white arrowhead indicates the original insertion site. The insertion sites generated by remobilization events are shown in black. B: Results of transposon donor line 1 (which has an SB insertion in chromosome 10) are shown.

A moderately higher score of intrachromosomal transposition (43%; n = 7) was obtained when donor line 1 was used (Fig. 6B); however, the number of the identified insertion sites was small. A previous study showed that the intrachromosomal transposition of Minos is approximately 10% in the C. intestinalis genome (Hozumi et al., 2010), suggesting that SB has a higher frequency of intrachromosomal transposition than Minos in the C. intestinalis genome.

DISCUSSION

In the present study, we showed that the combination of the T2 transposon element and SB100X transposase has sufficient activity to cause germline transformation of C. intestinalis. SB showed germline transformation, entrapment of enhancers, and integration into gene coding regions at frequencies comparable to those of Minos. We established transposase lines of SB100X that can be used for the remobilization of SB in the C. intestinalis genome. New insertion lines of SB including enhancer detection lines can be created easily by genetic crossing between the transposase lines and transposon donor lines. The SB‐mediated transformation system of C. intestinalis provides us with a reliable method of germline transformation of this organism in addition to the Minos system, and this technological achievement will enable useful genetic approaches that can only be achieved with two transposon systems.

The Hyperactive Variants of SB Transposon and Transposase Improve the Efficiency of Transposition in C. intestinalis

In a previous study, we showed that the SB transposon has excision activity in C. intestinalis (Sasakura et al., 2007). However, the activity was low and insufficient for detecting transposition. In the present study, we used a hyperactive variant of the SB transposon (pT2; Cui et al., 2002) and SB transposase (SB100X; Mates et al., 2009). These variants increased both the excision and transposition activity of the SB system in C. intestinalis to achieve germline transformation, suggesting that artificial mutagenesis of transposon/transposase in laboratories is a good strategy to improve transformation systems. Laboratory‐made variants of transposons/transposases are good candidates for establishing germline transgenesis in organisms in which no known transposon shows sufficient activity for transformation.

The results of the present study suggest that the excision frequency of SB is higher—but the transposition activity of SB is approximately six‐fold lower—than that of Minos, when we estimated these parameters with plasmid‐based excision and transposition assay. One reason for SB's lower transposition frequency may be that a part of the SB copies was excised again from the transposed recipient vectors, due to the high excision activity of SB. Therefore, the transposition efficiency of SB would have been underestimated. Indeed, the frequency of germline transformation of the C. intestinalis germline with SB is comparable to that of Minos, suggesting that the transposition activity of these transposons may not be much different. The lower frequency of Minos excision compared with SB but its comparable frequency of germline transformation suggests, in other words, that a Minos copy excised from plasmids has a higher chance than SB to be integrated into another DNA in C. intestinalis. Minos and SB are classified in the same Tc1/mariner superfamily of transposons (Plasterk et al., 1999), and these transposons have multiple shared characters. However, their transposition mechanisms are expected to be different, which may cause the differences in excision and transposition activity between SB and Minos. For the improvement of germline transformation with these transposons, it is better to increase the efficiency of excision and transposition of Minos and SB, respectively.

Intrachromosomal Transposition of SB in the C. intestinalis Genome

SB showed a higher frequency of intrachromosomal transposition than Minos in the C. intestinalis genome. The intrachromosomal transposition of SB in C. intestinalis (30–42%) is lower than that in mouse (∼50% in Liang et al., 2009). One cause is probably the different chromosomal sizes in C. intestinalis and mouse. The genome size of C. intestinalis is estimated to be 160 Mbp per haploid, which is divided into 14 chromosomes. The mouse genome is over 2,500 Mbp, divided into 20 chromosomes per haploid (Mouse Genome Sequencing Consortium, 2002). Therefore, the average length of a chromosome of C. intestinalis is approximately 11 times less than that of mouse. The smaller chromosomes of C. intestinalis may be a cause of the lower frequency of intrachromosomal transposition in this organism compared with mouse. Despite the smaller chromosomes, the frequency of SB intrachromosomal transposition in C. intestinalis is not much different from that in the mouse genome. Therefore, SB has the same preference to the intrachromosomal transposition in C. intestinalis as in the mouse genome. It may be that SB has an inherent ability to undergo intrachromosomal transposition, or SB may use cofactor proteins conserved between C. intestinalis and mouse, as a previous study suggested that SB requires cofactors for its remobilization (Izsvak et al., 2002; Zayed et al., 2003).

Future Applications of SB in C. intestinalis

We are considering three applications using SB. First, modifiers of Minos‐based mutants can be created with SB. The modifier screening cannot be done with Minos, because adding Minos insertions to the background of Minos transgenic lines causes remobilization of the original insertions, which would cause loss of mutations. In C. intestinalis, mutagenesis with chemical mutagens is still inefficient (Moody et al., 1999), and identification of the causal gene(s) of mutants takes a long time. The SB system is a strong candidate for mutagenesis because of its high likelihood of being inserted into genes. The second application makes use of SB's higher frequency of intrachromosomal transposition compared with Minos. If an SB transgenic line that has an insertion close to a gene‐of‐interest is isolated, remobilization of the insertion will result in a higher probability of isolating mutant lines that have insertions into the targeted gene compared with random mutagenesis. Finally, deletion of the C. intestinalis genome can be done by using intrachromosomal transposition of SB and Cre‐loxP systems, as was shown in mouse (Kokubu et al., 2009). For this purpose, the combinatorial use of SB and Minos is essential. SB‐based germline transformation will bring about breakthroughs in the genetic approaches to C. intestinalis.

EXPERIMENTAL PROCEDURES

Wild‐Type Animals

Wild‐type Ciona intestinalis were collected from or cultivated in Onagawa Bay (Miyagi), Maizuru Bay (Kyoto), Sagami Bay (Kanagawa), Tosa Bay (Kochi), and Mukaishima (Hiroshima), Japan. Sperm and eggs were collected by cutting the sperm duct and egg duct, respectively.

Constructs

pAmpMinosneo: Minos with a neomycin‐resistant gene was amplified with the primers 5′‐actcggtcgccgcattacgagccccaaccactattaattcg‐3′ and 5′‐caagtcattctgagatatacgagccccaaccactattaattcg‐3′ using pMiLRneo as the template (Klinakis et al., 2000b). The pAmpMITE (Miskey et al., 2007) was subjected to PCR amplification with the primers 5′‐tctcagaatgacttggttgagtactc‐3′ and 5′‐atgcggcgaccgagttgctcttg‐3′. The two PCR products were fused with the InFusion system (Clontech, Mountain View, CA).

pT2dTPOG: The dTPOG cassette of pMiTSAdTPOG was subcloned into PstI and BglII sites of pT2HB.

pT2tet and pT2tet(L): SpeI (blunted) and HindIII fragment of the tetracyclin‐resistant gene of pMiLRtet(L) (Klinakis et al., 2000a) was inserted into HindIII and EcoRV sites of pT2HB to create pT2tet. Then pT2tet was subjected to PCR with the primers 5′‐gatcgcggccgcagtctatacagttgaagtcggaag‐3′ and 5′‐atactaggatccagtctatacagttgaagtcggaag‐3′. pLorist6 backbone was amplified from pMiLRtet(L) with the primers 5′‐aaaagtactattgtcgttagaacgcggctac‐3′ and 5′‐aaaagtactgtgtcagaggttttcaccgtc‐3′ and digested with ScaI. The two PCR products were fused with the InFusion system to create pT2tet(L).

pRN3SB11 and pRN3SB100X: The cDNA of SB11 and SB100X was amplified by PCR with the primers 5′‐ggggatccaccatgggaaaatcaaaagaaatcag‐3′ and 5′‐tggaattcctagtatttggtagcattgc‐3′. The PCR fragments were digested with BamHI and EcoRI, and were inserted into the BglII/EcoRI sites of pBS‐RN3 (Lemaire et al., 1993).

pMiFr3dTPOCDestF: The eGFP cDNA was replaced by eCFP cDNA to create pSPeCFP. The Fr3dTPO cassette of pSPFr3dTPOG (Matsuoka et al., 2005) was amplified with the primers 5′‐gaactcgagcagctgaagcttg‐3′ and 5′‐cattctaatttgtctcgtttatttgtg‐3′ and subcloned into the blunted BamHI site of pSPeCFP to create pSPFr3dTPOC. Fr3dTPOC cassette was PCR‐amplified with the primers 5′‐gaactcgagcagctgaagcttg‐3′ and 5′‐gcagatctgatggccgctttgac‐3′, digested with BglII and inserted into the SmaI and BamHI sites of pMiLRneo (Klinakis et al., 2000b) to create pMiFr3dTPOC. The RfC1 cassette (Invitrogen, Carlsbad, CA) was then inserted into the EcoRV site of pMiFr3dTPOC.

pMiFr3dTPOCCiNutSB100X and pMiFr3dTPOCCiPrmSB100X: The multicloning site and eGFP cDNA of pSP‐eGFP (Sasakura et al., 2003b) was subcloned into pDONR221 by the gateway system (Invitrogen) to create pLMCSeGFP. SB100X cDNA was amplified with the primers described above, digested with BamHI and EcoRI, and inserted into the BamHI and EcoRI sites of pLMCSeGFP to create pLMCSSB100X. The BamHI fragments of Ci‐prm and Ci‐Nut promoters (Sasakura et al., 2008; Hozumi et al., 2010) were inserted into the BamHI site of pLMCSSB100X to create pLCiNutSB100X and pLCiprmSB100X. The NutSB100X and CiprmSB100X cassettes were inserted into pMiFr3dTPOCDestF by the Gateway System (Invitrogen).

Microinjection, Electroporation, and Transgenic Lines

Transposase mRNAs were synthesized with the Megascript T3 kit, poly (A) tailing kit (Ambion, Carlsbad, CA) and Cap structure analog (New England Biolabs, Ipswich, MA). For the excision assay, a mixture of 5 ng/μL of transposon DNA and 50 ng/μL of transposase mRNA was microinjected into one‐cell‐stage embryos. Sixty micrograms of vector DNA and 80 μg of transposase mRNA were simultaneously electroporated with GenePulser Xcell (Bio‐Rad, Hercules, CA) at the parameters of 20 ms, 50 V. Transgenic lines were cultured by an inland system described elsewhere (Joly et al., 2007).

Excision Assay

Late tail bud embryos were digested in 50 μL of 1× TE containing 0.2 μg/μL Proteinase K for 3 hr at 50°C, followed by 15 min at 95°C to inactivate Proteinase K. One microliter of the extract was subjected to PCR analysis with the primers 5′‐gaaacagctatgaccatgatt‐3′ and 5′‐gtaaaacgacggccagtg‐3′ and ExTaq hot start version (Takara Bio, Shiga, Japan). The program of PCR was 60 cycles at 30 sec at 94°C, 30 sec at 55°C, 30 sec at 72°C, then 10 min at 72°C for final extension. The PCR products were subcloned into pGEMT (Promega, Madison, WI) for sequencing analysis. We judged the footprint sequences based on the following two characteristics: (1) the transposon sequence, except for the five terminal nucleotides of the inverted repeats, was absent from the excised band; and (2) the vector backbone sequence remained in total.

Detecting the excision of transposons from ampicillin‐resistant genes was done as follows. Thirty micrograms of a pAmp vector and 0–80 μg of transposase mRNA were simultaneously electroporated. pLCiNutMiTP (Hozumi et al., 2010), pLCiNutSB100X, pLCiNutSB11, and pLCiNutSB10 were also used as transposase‐expression vectors. In this case, 30 μg of an expression vector was electroporated together with 30 μg of a pAmp vector. The electroporated embryos were rinsed five times to reduce the background. Plasmid DNA was recovered from late tail bud embryos and used to transform E. coli by electroporation. Two to five percent of the electroporated E. coli was plated on an LB plate containing 25 μg/ml zeocin to estimate the total number of recovered pAmp vector. The remaining E. coli was plated on an LB plate containing 100 μg/ml ampicillin and 25 μg/ml zeocin. The number of colonies was counted to score the efficiency of excision.

Transposition Assay

Twenty micrograms of a donor vector, 40 μg of a recipient vector and 0–80 μg of transposase mRNA were simultaneously electroporated into one‐cell embryos. Plasmid DNA was recovered from late tail bud embryos and used to transform E. coli by electroporation. Two percent of the electroporated E. coli was plated on an LB plate containing 30 μg/ml chloramphenicol to estimate the total number of recovered recipient vectors (N_recovery). The remaining E. coli was plated on an LB plate containing 15 μg/ml chloramphenicol and 12 μg/ml tetracyclin. The colonies were duplicated on an LB plate containing 15 μg/ml chloramphenicol, 12 μg/ml tetracyclin and 50 μg/ml kanamycin. Plasmid DNA was extracted from chloramphenicol‐ and tetracyclin‐resistant but kanamycin‐sensitive clones. The plasmid DNA was digested with NotI to test whether it was a product of the transposition (N_transposed). Appropriate plasmids were subjected to a sequencing analysis with the primers 5′‐cgcgggacgttacacaattc‐3′ and 5′‐cagctctgcattatttgc‐3′ to determine the insertion sites. The transposition frequency was the ratio of transposed plasmids among the recovered recipient vectors calculated by the formula N_transposed /(49 × N_recovery).

Genome Analyses and RT‐PCR

Genomic Southern blotting of GFP gene was done according to a previous study (Hozumi et al., 2010). The genomic DNA isolated from sperm of the transgenic lines was digested with EcoRV and electrophoresed. After blotting on Hybond N+ nylon membrane (GE Healthcare), the GFP gene was detected by the digoxigenin‐labeled GFP probe synthesized with a DIG PCR labeling kit (Roche). The sequences of the primers specific to pT2dTPOG used for the 1st, 2nd, and 3rd rounds of the thermal asymmetric interlaced (TAIL)‐PCR (Liu et al., 1995; Sasakura et al., 2003d) were 5′‐gacccactggaattgtgatacagtg‐3′, 5′‐taatctgtctgtaaacaattgttgg‐3′, and 5′‐tggaaaaatgacttgtgtcatgcac‐3′ for the left side of the inverted repeat, and 5′‐gacccactgggaatgtgatgaaaga‐3′, 5′‐gaatcattctctctactattattctg‐3′, and 5′‐agtggtgatcctaactgacctaag‐3′ for the right side of the inverted repeat, respectively.

For the genomic PCR analyses of juveniles, each juvenile with enhancer detection was digested in 50 μL of 1 × TE buffer containing 0.2 μg/μl of Proteinase K at 50°C for 3 hr, followed by incubation at 95°C for 15 min to inactivate Proteinase K. One microliter of the solution was used for PCR analyses with primers that flank the junction sequence between SB and the Ciona genome. GFP gene was amplified with primers 5′‐gcattgaattcttacttgtac‐3′ and 5′‐gggacacaagctggagtacaact‐3′.

Total RNA was isolated from the testes of male transposase lines (Ju[MiFr3dTPORCiprmSB100X]1 and 2) and the dechorionated unfertilized eggs of the female transposase line (Ju[MiFr3dTPORCiNutSB100X]1) by AGPC methods (Sambrook et al., 1989) with Isogen (Wako, Richmond, VA). Residual DNA was digested with DNaseI (Takara Bio). Following reverse transcription (RT), PCR was performed according to the previous report (Hozumi et al., 2010) with the primers 5′‐gtctcctagagatgaacgtact‐3′ and 5′‐cctgactgatgtcttgagatgt‐3′ for SB100X. As a positive control of reverse transcription, EF1a and GAPDH were amplified with the primers 5′‐ttggacaaacttaaggccgagc‐3′ and 5′‐gtctccagcaacataacctctc‐3′ for EF1a, and 5′‐tcggaatcaacggtttcggacg‐3′ and 5′‐cgatgacacggttgctgtatcc‐3′ for GAPDH.

Acknowledgements

The authors thank the members of the Shimoda Marine Research Center at the University of Tsukuba for their kind cooperation during our study. We thank the National Bioresource Project, MEXT, and all members of the Maizuru Fishery Research Station of Kyoto University, the International Coast Research Center of the Ocean Research Institute of the University of Tokyo, the Education and Research Center of Marine Bioresources of Tohoku University, Drs. Nobuo Yamaguchi, Kunifumi Tagawa and Shigeki Fujiwara and his colleagues for providing us with Ciona adults. Dr. Charalambos Savakis is acknowledged for his kind provision of Minos. We are grateful to Dr. Perry Hackett for his kind provision of pT2HB and comments to this manuscript. Y.S. was funded by JSPS and MEXT.

REFERENCES

Awazu S, Sasaki A, Matsuoka T, Satoh N, Sasakura Y. 2004. An enhancer trap in the ascidian Ciona intestinalis identifies enhancers of its Musashi orthologous gene. Dev Biol 275: 459– 472.
Crossref CAS PubMed Web of Science®Google Scholar
Awazu S, Matsuoka T, Inaba K, Satoh N, Sasakura Y. 2007. High‐throughput enhancer trap by remobilization of transposon Minos in Ciona intestinalis. Genesis 45: 307– 317.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Cui Z, Geurts AM, Liu G, Kaufman CD, Hackett PB. 2002. Structure‐function analysis of the inverted terminal repeats of the sleeping beauty transposon. J Mol Biol 318: 1221– 1235.
Crossref CAS PubMed Web of Science®Google Scholar
Davidson AE, Balciunas D, Mohn D, Shaffer J, Hermanson S, Sivasubbu S, Cliff MP, Hackett PB, Ekker SC. 2003. Efficient gene delivery and gene expression in zebrafish using the Sleeping Beauty transposon. Dev Biol 263: 191– 202.
Crossref CAS PubMed Web of Science®Google Scholar
Dehal P, Satou Y, Campbell RK, Chapman J, Degnan B, De Tomaso A, Davidson B, Di Gregorio A, Gelpke M, Goodstein DM, Harafuji N, Hastings KE, Ho I, Hotta K, Huang W, Kawashima T, Lemaire P, Martinez D, Meinertzhagen IA, Necula S, Nonaka M, Putnam N, Rash S, Saiga H, Satake M, Terry A, Yamada L, Wang HG, Awazu S, Azumi K, Boore J, Branno M, Chin‐Bow S, DeSantis R, Doyle S, Francino P, Keys DN, Haga S, Hayashi H, Hino K, Imai KS, Inaba K, Kano S, Kobayashi K, Kobayashi M, Lee BI, Makabe KW, Manohar C, Matassi G, Medina M, Mochizuki Y, Mount S, Morishita T, Miura S, Nakayama A, Nishizaka S, Nomoto H, Ohta F, Oishi K, Rigoutsos I, Sano M, Sasaki A, Sasakura Y, Shoguchi E, Shin‐I T, Spagnuolo A, Stainier D, Suzuki MM, Tassy O, Takatori N, Tokuoka M, Yagi K, Yoshizaki F, Wada S, Zhang C, Hyatt PD, Larimer F, Detter C, Doggett N, Glavina T, Hawkins T, Richardson P, Lucas S, Kohara Y, Levine M, Satoh N, Rokhsar DS. 2002. The draft genome of Ciona intestinalis: Insight into chordate and vertebrate origins. Science 298: 2157– 2167.
Crossref CAS PubMed Web of Science®Google Scholar
Deschet K, Nakatani Y, Smith WC. 2003. Generation of Ci‐Brachyury‐GFP stable transgenic lines in the ascidian Ciona savignyi. Genesis 35: 248– 259.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Di Gregorio A, Levine M. 2002. Analyzing gene regulation in ascidian embryos: new tools for new perspectives. Differentiation 70: 132– 139.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Fischer SE, Wienholds E, Plasterk RHA. 2001. Regulated transposition of a fish transposon in the mouse germ line. Proc Natl Acad Sci U S A 98: 6759– 6764.
Crossref CAS PubMed Web of Science®Google Scholar
Franz G, Savakis CC. 1991. Minos, a new transposable element from Drosophila hydei, is a member of the Tc1‐like family of transposons. Nucleic Acid Res 19: 6646.
Crossref CAS PubMed Web of Science®Google Scholar
Geurts AM, Yang Y, Clark KJ, Liu G, Cui Z, Dupuy AJ, Bell JB, Largaespada DA, Hackett PB. 2003. Gene transfer into genomes of human cells by the sleeping beauty transposon system. Mol Ther 8: 108– 117.
Crossref CAS PubMed Web of Science®Google Scholar
Grabher C, Henrich T, Sasado T, Arenz A, Wittbrodt J, Furutani‐Seiki M. 2003. Transposon‐mediated enhancer trapping in medaka. Gene 322: 57– 66.
Crossref CAS PubMed Web of Science®Google Scholar
Horie K, Kuroiwa A, Ikawa M, Okabe M, Kondoh G, Matsuda Y, Takeda J. 2001. Efficient chromosomal transposition of a Tc1/mariner‐ like transposon Sleeping Beauty in mice. Proc Natl Acad Sci U S A 98: 9191– 9196.
Crossref CAS PubMed Web of Science®Google Scholar
Huet F, Lu JT, Myrick KV, Baugh LR, Crosby MA, Gelbart WM. 2002. A deletion‐generator compound element allows deletion saturation analysis for genomewide phenotypic annotation. Proc Natl Acad Sci U S A 99: 9948– 9953.
Crossref CAS PubMed Web of Science®Google Scholar
Hozumi A, Kawai N, Yoshida R, Ogura Y, Ohta N, Satake H, Satoh N, Sasakura Y. 2010. Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs. Dev Dyn 239: 1076– 1088.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Ivics Z, Izsvak Z. 2010. The expanding universe of transposon technologies for gene and cell engineering. Mob DNA 1: 25.
Crossref CAS PubMed Web of Science®Google Scholar
Ivics Z, Plasterk RH, Hackett PB, Izsvak Z. 1997. Molecular reconstruction of Sleeping Beauty, a Tc1‐like transposon from fish, and its transposition in human cells. Cell 91: 501– 510.
Crossref CAS PubMed Web of Science®Google Scholar
Izsvak Z, Khare D, Behlke J, Heinemann U, Plasterk RH, Ivics Z. 2002. Involvement of a bifunctional, paired‐like DNA‐binding domain and a transpositional enhancer in Sleeping Beauty transposition. J Biol Chem 277: 34581– 34588.
Crossref CAS PubMed Web of Science®Google Scholar
Joly JS, Kano S, Matsuoka T, Auger H, Hirayama K, Satoh N, Awazu S, Legendre L, Sasakura Y. 2007. Culture of Ciona intestinalis in closed systems. Dev Dyn 236: 1832– 1840.
Wiley Online Library PubMed Web of Science®Google Scholar
Kitaura Y, Sonobe H, Tanaka O, Honda D, Watanabe Y, Makabe KW, Takamura K, Nishikata T. 2007. Neural‐tube specific paralogous genes and their upstream regulatory sequences. Mem Konan Univ Sci Eng Ser 54: 75– 88.
CAS Google Scholar
Klinakis AG, Loukeris TG, Pavlopoulos A, Savakis C. 2000a. Mobility assays confirm the broad host‐range activity of the Minos transposable element and validate new transformation tools Insect Mol Biol 9: 269– 275.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Klinakis AG, Zagoraiou L, Vassilatis DK, Savakis C. 2000b. Genome‐wide insertional mutagenesis in human cells by the Drosophila mobile element Minos. EMBO Rep 1: 416– 421.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Kokubu C, Horie K, Abe K, Ikeda R, Mizuno S, Uno Y, Ogiwara S, Ohtsuka M, Isotani A, Okabe M, Imai K, Takeda J. 2009. A transposon‐based chromosomal engineering method to survey a large cis‐regulatory landscape in mice. Nat Genet 41: 946– 952.
Crossref CAS PubMed Web of Science®Google Scholar
Lampe D, Churchill MEA, Robertson HM. 1996. A purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J 15: 5470– 5479.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Lemaire P, Garrett N, Gurdon JB. 1993. Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal‐vegetal cells of blastulae and able to induce a complete secondary axis. Cell 81: 85– 94.
Crossref PubMed Web of Science®Google Scholar
Liang Q, Kong J, Stalker J, Bradley A. 2009. Chromosomal mobilization and reintegration of Sleeping Beauty and PiggyBac transposons. Genesis 47: 404– 408.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Liu YG, Mitsukawa N, Oosumi T, Whittier RF. 1995. Efficient isolation and mapping of Arabidopsis thaliana T‐DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8: 457– 463.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Luo G, Ivics Z, Izsvak Z, Bradley A. 1998. Chromosomal transposition of a Tc1/mariner‐like element in mouse embryonic stem cells. Proc Natl Acad Sci U S A 95: 10769– 10773.
Crossref CAS PubMed Web of Science®Google Scholar
Mates L, Chuah MK, Belay E, Jerchow B, Manoj N, Acosta‐Sanchez A, Grzela DP, Schmitt A, Becker K, Matrai J, Ma L, Samara‐Kuko E, Gysemans C, Pryputniewicz D, Miskey C, Fletcher B, VandenDriessche T, Ivics Z, Izsvak Z. 2009. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet 41: 753– 761.
Crossref CAS PubMed Web of Science®Google Scholar
Matsuoka T, Awazu S, Shoguchi E, Satoh N, Sasakura Y. 2005. Germline transgenesis of the ascidian Ciona intestinalis by electroporation. Genesis 41: 61– 72.
Wiley Online Library CAS Web of Science®Google Scholar
Miskey C, Papp B, Mates L, Sinzelle L, Keller H, Izsvak Z, Ivics Z. 2007. The ancient mariner sails again: transposition of the human Hsmar1 element by a reconstructed transposase and activities of the SETMAR protein on transposon ends. Mol Cell Biol 27: 4589– 4600.
Crossref CAS PubMed Web of Science®Google Scholar
Moody R, Davis SW, Cubes F, Smith WC. 1999. Isolation of developmental mutants of the ascidian Ciona savignyi. Mol. Gen. Genet. 262: 199– 206.
Crossref CAS PubMed Web of Science®Google Scholar
Mouse Genome Sequencing Consortium. 2002. Initial sequencing and comparative analysis of the mouse genome. Nature 420: 520– 562.
Crossref CAS PubMed Web of Science®Google Scholar
Newman M, Lardelli M. 2010. A hyperactive sleeping beauty transposase enhances transgenesis in zebrafish embryos. BMC Res Notes 3: 282.
Crossref CAS PubMed Google Scholar
Ogasawara M, Di Lauro R, Satoh N. 1999. Ascidian homologs of mammalian thyroid peroxidase genes are expressed in the thyroid‐equivalent region of the endostyle. J Exp Zool 285: 158– 169.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
O'Kane C, Gehring WJ. 1987. Detection in situ of genomic regulatory elements in Drosophila. Proc Natl Acad Sci U S A 84: 9123– 9127.
Crossref CAS PubMed Web of Science®Google Scholar
Plasterk RH, van Luenen HG. 1997. Transposons. In: DL Riddle, T Blumenthal, BJ Meyer, JR Priess, editors. C. elegans II. New York: Cold Spring Harbor Laboratory Press. p 97– 116.
Google Scholar
Plasterk R, Izsvak Z, Ivics Z. 1999. Resident aliens: the Tc1/mariner superfamily of transposable elements. Trends Genet 15: 326– 332.
Crossref CAS PubMed Web of Science®Google Scholar
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory.
Google Scholar
Sasakura Y. 2007. Germline transgenesis and insertional mutagenesis in the ascidian Ciona intestinalis. Dev Dyn 236: 1758– 1767.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Sasakura Y, Yamada L, Takatori N, Satou Y, Satoh N. 2003a. A genomewide survey of developmentally relevant genes in Ciona intestinalis. VII. Molecules involved in the regulation of cell polarity and actin dynamics. Dev Genes Evol 213: 273– 283.
Crossref CAS PubMed Web of Science®Google Scholar
Sasakura Y, Shoguchi E, Takatori N, Wada S, Meinertzhagen IA, Satou Y, Satoh N. 2003b. A genomewide survey of developmentally relevant genes in Ciona intestinalis. X. Genes for cell junctions and extracellular matrix. Dev Genes Evol 213: 303– 313.
Crossref CAS PubMed Web of Science®Google Scholar
Sasakura Y, Awazu S, Chiba S, Kano S, Satoh N. 2003c. Application of Minos, one of the Tc1/mariner superfamily transposable elements, to ascidian embryos as a tool for insertional mutagenesis. Gene 308: 11– 20.
Crossref CAS PubMed Web of Science®Google Scholar
Sasakura Y, Awazu S, Chiba S, Satoh N. 2003d. Germ‐line transgenesis of the Tc1/mariner superfamily transposon Minos in Ciona intestinalis. Proc Natl Acad Sci U S A 100: 7726– 7730.
Crossref CAS PubMed Web of Science®Google Scholar
Sasakura Y, Oogai Y, Matsuoka T, Satoh N, Awazu S. 2007. Transposon‐mediated transgenesis in a marine invertebrate chordate, Ciona intestinalis. Genome Biol 8: S3.
Crossref PubMed Web of Science®Google Scholar
Sasakura Y, Konno A, Mizuno K, Satoh N, Inaba K. 2008. Enhancer detection in the ascidian Ciona intestinalis with transposase‐expressing lines of Minos. Dev Dyn 237: 39– 50.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Sasakura Y, Nakashima K, Awazu S, Matsuoka T, Nakayama A, Azuma J, Satoh N. 2005. Transposon‐mediated insertional mutagenesis revealed the functions of animal cellulose synthase in the ascidian Ciona intestinalis. Proc. Natl. Acad. Sci. USA 102: 15134– 15139.
Crossref CAS PubMed Web of Science®Google Scholar
Sasakura Y, Kanda M, Ikeda T, Horie T, Kawai N, Ogura Y, Yoshida R, Hozumi A, Satoh N, Fujiwara S. 2012. Retinoic acid‐driven Hox1 is required in the epidermis for forming the otic/atrial placodes during ascidian metamorphosis. Development 139: 2156– 2160.
Crossref CAS PubMed Web of Science®Google Scholar
Satoh N. 2003. The ascidian tadpole larva: comparative molecular development and genomics. Nat Rev Genet 4: 285– 295.
Crossref CAS PubMed Web of Science®Google Scholar
Shoguchi E, Hamaguchi M, Satoh N. 2008. Genome‐wide network of regulatory genes for construction of a chordate embryo. Dev Biol 316: 498– 509.
Crossref CAS PubMed Web of Science®Google Scholar
Simmons MJ, Haley KJ, Grimes CD, Raymond JD, Niemi JB. 2002. A hobo transgene that encodes the P‐element transposase in Drosophila melanogaster: autoregulation and cytotype control of transposase activity. Genetics 161: 195– 204.
CAS PubMed Web of Science®Google Scholar
Sinzelle L, Vallin J, Coen L, Chesneau A, Du Pasquier D, Pollet N, Demeneix B, Mazabraud A. 2006. Generation of transgenic Xenopus laevis using the Sleeping Beauty transposon system. Transgenic Res 15: 751– 760.
Crossref CAS PubMed Web of Science®Google Scholar
Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM, Buchholz R, Demsky M, Fawcett R, Francis‐Lang HL, Ryner L, Cheung LM, Chong A, Erickson C, Fisher WW, Greer K, Hartouni SR, Howie E, Jakkula L, Joo D, Killpack K, Laufer A, Mazzotta J, Smith RD, Stevens LM, Stuber C, Tan LR, Ventura R, Woo A, Winberg ML, Margolis J. 2004. A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat Genet 36: 283– 287.
Crossref CAS PubMed Web of Science®Google Scholar
van Luenen HG, Colloms SD, Plasterk RH. 1994. The mechanism of transposition of Tc3 in C. elegans. Cell 79: 293– 301.
Crossref CAS PubMed Web of Science®Google Scholar
Vos JC, De Baere I, Plasterk RH. 1996. Tc1 transposase is the only nematode protein required for in vitro transposition of Tc1. Genes Dev 10: 755– 761.
Crossref CAS PubMed Web of Science®Google Scholar
Yoshida R, Sasakura Y. 2012. Establishment of enhancer detection lines expressing GFP in the gut of the ascidian Ciona intestinalis. Zoolog Sci 29: 11– 20.
Crossref CAS PubMed Web of Science®Google Scholar
Zayed H, Izsvak Z, Khare D, Heinemann U, Ivics Z. 2003. The DNA‐bending protein HMGB1 is a cellular cofactor of Sleeping Beauty transposition. Nucleic Acids Res 31: 2313– 2322.
Crossref CAS PubMed Web of Science®Google Scholar

Citing Literature

Volume242, Issue1

January 2013

Pages 30-43

Germline transgenesis of the chordate Ciona intestinalis with hyperactive variants of sleeping beauty transposable element

Abstract

INTRODUCTION

RESULTS

Excision Activity of Sleeping Beauty With its Transposase Variants in C. intestinalis

SB100X Can Transpose T2 Vector in C. intestinalis

Germline Transformation of C. intestinalis With SB

Remobilization of SB in the C. intestinalis Genome

The Tendency of the SB Insertion Sites in the C. intestinalis Genome

DISCUSSION

The Hyperactive Variants of SB Transposon and Transposase Improve the Efficiency of Transposition in C. intestinalis

Intrachromosomal Transposition of SB in the C. intestinalis Genome

Future Applications of SB in C. intestinalis

EXPERIMENTAL PROCEDURES

Wild‐Type Animals

Constructs

Microinjection, Electroporation, and Transgenic Lines

Excision Assay

Transposition Assay

Genome Analyses and RT‐PCR

Acknowledgements

REFERENCES

Citing Literature

Figures

References

Information

About Wiley Online Library

Help & Support

Opportunities

Connect with Wiley

Germline transgenesis of the chordate Ciona intestinalis with hyperactive variants of sleeping beauty transposable element

Abstract

INTRODUCTION

RESULTS

Excision Activity of Sleeping Beauty With its Transposase Variants in C. intestinalis

SB100X Can Transpose T2 Vector in C. intestinalis

Germline Transformation of C. intestinalis With SB

Remobilization of SB in the C. intestinalis Genome

The Tendency of the SB Insertion Sites in the C. intestinalis Genome

DISCUSSION

The Hyperactive Variants of SB Transposon and Transposase Improve the Efficiency of Transposition in C. intestinalis

Intrachromosomal Transposition of SB in the C. intestinalis Genome

Future Applications of SB in C. intestinalis

EXPERIMENTAL PROCEDURES

Wild‐Type Animals

Constructs

Microinjection, Electroporation, and Transgenic Lines

Excision Assay

Transposition Assay

Genome Analyses and RT‐PCR

Acknowledgements

REFERENCES

Citing Literature

Figures

References

Related

Information